Review



2×multif seamless assembly mix one-step cloning kit  (ABclonal Biotechnology)


Bioz Verified Symbol ABclonal Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ABclonal Biotechnology 2×multif seamless assembly mix one-step cloning kit
    2×Multif Seamless Assembly Mix One Step Cloning Kit, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2%C3%97multif+seamless+assembly+mix+one-step+cloning+kit/multif+seamless+assembly+mix+kit/pm39666994__jf4c07745_si_001-1-118-121
    Average 90 stars, based on 1 article reviews
    2×multif seamless assembly mix one-step cloning kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    Mutagenesis:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    Cloning:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    Plasmid Preparation:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    DNA Extraction:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    Polymerase Chain Reaction:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.

    Bradford Protein Assay:

    Article Title: High-Throughput Screening for Enhanced Thermal Stability of Inherently Salt-Tolerant l-Glutaminase and Its Efficient Expression in Bacillus licheniformis .
    Article Snippet: *Corresponding authors: Prof. Xian Zhang, *E-mail: zx@jiangnan.edu.cn, Tel: +86-13771401977 #Yanglu Hu and Hengwei Zhang contributed equally to this paper S2 Table S1 Bacterial strains, plasmids used in this study Strains/plasmids usage Source Strains B. subtilis 168 Strain for expressing L-glutaminase in construction of random mutagenesis library of LreuglsA Tis lab E. coli BL21 Strain for cloning plasmid in construction of random mutagenesis library of LreuglsA; Strain for expressing histidine-tagged L- glutaminase Tis lab Bacillus licheniformis Strain for expressing mutant A146D Tis lab Plasmids pMA5 Vectors for constructing random mutagenesis library of LreuglsA and expressing of L-glutaminase in Bacillus licheniformis Tis lab pET-28a Vectors for expressing histidine-tagged L-glutaminase Tis lab S3 Name Commercial supplier Address 2×MultiF Seamless Assembly Mix One-Step Cloning Kit ABclonal Technology Wuhan, China Restriction endonuclease and PrimeSTAR Max Premix TaKaRa Dalian, China 2× Phanta Max Master Mix P525-AA Vazyme Nanjing, China FastPure Gel DNA Extraction Mini Kit Vazyme Nanjing, China 2×Easy Taq PCR SuperMix (+Dye) TransGen Biotech Beijing, China EasyPure Plasmid MiniPrep Kit TransGen Biotech Beijing, China QuickMutat onTM Gene Random Mutagenesis Kit Beyotime Biotechnolog Shanghai, China Bradford Protein Assay Kit Sangon Biotech Shanghai, China Table S3 Primers used in this study Name Primer (5′→3′) P1 AGAAAGGAGGAATATATAATGAATCTGAACGATGCCATCCA AGAATGP2 TCGACCTCTAGAACGCGTTTAGTAGCGGAACACGTCCAGCTT P3 ACGCGTTCTAGAGGTCGAAATTCAC P4 TATATATTCCTCCTTTCTTATATACACAAATGTGAGGCATTTT CGP5 CAAATGGGTCGCGGATCCATGAATCTGAACGATGCCATCCAA GAAP6 TGCGGCCGCAAGCTTTTA T GCGGAACACGTCCAGCTT P7 AAGCTTGCGGCCGCACT P8 GGATCCGCGACCCATTTGCTGT P9 AATGATCCAGATATCACGCTGAACGAGGAGA P10 CGTGATATCTGGATCATTGCAGATCTTGCGG S4 P2 were used to amplify the structural gene of LreuglsA from pET-28a containing the structural gene Lreu, and P3 and P4 were used to linearize the plasmid pMA5.



    Similar Products

    2×multif seamless assembly mix one-step cloning kit  (ABclonal Biotechnology)
    90
    ABclonal Biotechnology 2×multif seamless assembly mix one-step cloning kit
    2×Multif Seamless Assembly Mix One Step Cloning Kit, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2%C3%97multif+seamless+assembly+mix+one-step+cloning+kit/multif+seamless+assembly+mix+kit/pm39666994__jf4c07745_si_001-1-118-121
    Average 90 stars, based on 1 article reviews
    2×multif seamless assembly mix one-step cloning kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results